Human Ntn4(Netrin 4) ELISA Kit

Human Ntn4(Netrin 4) ELISA Kit

Human Netrin 4 (Ntn4) ELISA Kit
RD-Ntn4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Netrin 4 (Ntn4) ELISA Kit
RD-Ntn4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Netrin 4 (Ntn4) ELISA Kit
RDR-Ntn4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Netrin 4 (Ntn4) ELISA Kit
RDR-Ntn4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Netrin-4 (NTN4)
RA21023	Neuromics	50 ug	EUR 435

Human Netrin-4 (NTN4) ELISA Kit
abx576155-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human NTN4/ Netrin-4 ELISA Kit
E1805Hu	Sunlong	1 Kit	EUR 571

Human NTN4(Netrin-4) ELISA Kit
EH1954	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Uniprot ID: Q9HB63 Alias: NTN4(Netrin 4)/beta-Netrin/Netrin-4/CDY/CDY1A/chromodomain protein, Y chromosome, 1/chromodomain protein, Y-linked, 1/testis-specific chromodomain protein on Y/testis-specific chromodomain Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Netrin- 4, NTN4 ELISA KIT
ELI-05910h	Lifescience Market	96 Tests	EUR 824

Human Netrin-4(Ntn4)ELISA Kit
GA-E1314HM-48T	GenAsia Biotech	48T	EUR 289

Human Netrin-4(Ntn4)ELISA Kit
GA-E1314HM-96T	GenAsia Biotech	96T	EUR 466

Human Netrin-4 (NTN4) ELISA Kit
20-abx152484	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Netrin-4 (NTN4) ELISA Kit
abx251276-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Netrin-4,Ntn4 ELISA Kit
201-12-1298	SunredBio	96 tests	EUR 440
This Netrin-4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Netrin-4, Ntn4 ELISA Kit
CSB-E11900h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Netrin-4, Ntn4 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Netrin-4, Ntn4 ELISA Kit
1-CSB-E11900h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Netrin-4, Ntn4 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Netrin 4 (Ntn4) ELISA Kit
SEB835Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 4 (Ntn4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 4 (Ntn4) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Netrin 4 (Ntn4) ELISA Kit
SEB835Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 4 (Ntn4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 4 (Ntn4) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Netrin 4 (Ntn4) ELISA Kit
SEB835Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 4 (Ntn4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 4 (Ntn4) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Netrin 4 (Ntn4) ELISA Kit
SEB835Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 4 (Ntn4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 4 (Ntn4) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Netrin 4 (Ntn4) ELISA Kit
4-SEB835Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Netrin 4 elisa. Alternative names of the recognized antigen: Beta-Netrin Hepar-derived netrin-like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Netrin 4 (Ntn4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Netrin 4 ELISA Kit (Ntn4)
RK01972	Abclonal	96 Tests	EUR 521

Human Netrin-4(Ntn4)ELISA Kit
QY-E00142	Qayee Biotechnology	96T	EUR 361

Netrin 4 (Ntn4) Antibody
20-abx128812	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Netrin 4 (Ntn4) Antibody
20-abx173747	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Netrin-4 (NTN4) Antibody
abx432030-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Recombinant Netrin 4 (Ntn4)
4-RPB835Hu01	Cloud-Clone	EUR 483.49 EUR 232.00 EUR 1538.08 EUR 579.36 EUR 1058.72 EUR 386.00 EUR 3695.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9HB63 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 59.3kDa Isoelectric Point: 7
Description: Recombinant Human Netrin 4 expressed in: E.coli

Mouse Netrin-4 (NTN4) ELISA Kit
abx518574-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Monkey Netrin-4 (NTN4) ELISA Kit
abx360314-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Netrin-4 (NTN4) ELISA Kit
abx362075-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Netrin-4 (NTN4) ELISA Kit
abx363302-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Netrin- 4, Ntn4 ELISA KIT
ELI-05909m	Lifescience Market	96 Tests	EUR 865

Sheep Netrin-4 (NTN4) ELISA Kit
abx364688-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Chicken Netrin-4 (NTN4) ELISA Kit
abx356839-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Netrin-4(NTN4) ELISA kit
CSB-EL016129MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Netrin-4 (NTN4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Netrin-4(NTN4) ELISA kit
1-CSB-EL016129MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Netrin-4(NTN4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Netrin 4 (Ntn4) Protein
20-abx166809	Abbexa	EUR 676.00 EUR 272.00 EUR 2068.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Netrin-4 (NTN4) CLIA Kit
20-abx493140	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Netrin 4 (Ntn4) CLIA Kit
abx197331-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ELISA kit for Human Ntn4 (Netrin 4)
E-EL-H2329	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's Ntn4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human Ntn4. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human Ntn4 (Netrin 4) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Ntn4 (Netrin 4)
ELK2211	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Netrin 4 (Ntn4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Netrin 4 (Ntn4). N Show more
Description: A sandwich ELISA kit for detection of Netrin 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

CLIA kit for Human Ntn4 (Netrin 4)
E-CL-H1361	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's Ntn4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human Ntn4 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human Ntn4 (Netrin 4) in samples from Serum, Plasma, Cell supernatant

Netrin 4 (Ntn4) Polyclonal Antibody (Human)
4-PAB835Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ntn4 (Glu349~His592) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4)

Netrin 4 (Ntn4) Polyclonal Antibody (Human), APC
4-PAB835Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ntn4 (Glu349~His592) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with APC.

Netrin 4 (Ntn4) Polyclonal Antibody (Human), Biotinylated
4-PAB835Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ntn4 (Glu349~His592) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with Biotin.

Netrin 4 (Ntn4) Polyclonal Antibody (Human), Cy3
4-PAB835Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ntn4 (Glu349~His592) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with Cy3.

Netrin 4 (Ntn4) Polyclonal Antibody (Human), FITC
4-PAB835Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ntn4 (Glu349~His592) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with FITC.

Netrin 4 (Ntn4) Polyclonal Antibody (Human), HRP
4-PAB835Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ntn4 (Glu349~His592) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with HRP.

Netrin 4 (Ntn4) Polyclonal Antibody (Human), PE
4-PAB835Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ntn4 (Glu349~His592) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with PE.

Netrin 4 (Ntn4) Polyclonal Antibody (Human), APC-Cy7
4-PAB835Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ntn4 (Glu349~His592) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with APC-Cy7.

Netrin-4
GT15164	Neuromics	100 ug	EUR 526

Human NTN4 ELISA Kit
ELA-E1835h	Lifescience Market	96 Tests	EUR 824

NTN4 ELISA KIT|Human
EF006061	Lifescience Market	96 Tests	EUR 689

Netrin 4 antibody
70R-7141	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Netrin 4 antibody raised against the N terminal of NTN4

NTN4 ELISA Kit (Human) (OKAN05746)
OKAN05746	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.5 pg/mL

NTN4 ELISA Kit (Human) (OKCD07716)
OKCD07716	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: NTN4 contains 3 laminin EGF-like domains, 1 laminin N-terminal domain and 1 NTR domain. NTN4 may play an important role in neural, kidney and vascular development. It promotes neurite elongation from olfactory bulb explants. NTN4 belongs to a family of proteins related to laminins (see LAMA1, MIM 150320) Koch et al. (2000)....;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 3.1pg/mL

NTN4 ELISA Kit (Human) (OKEH04720)
OKEH04720	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL

Netrin 4 Blocking Peptide
33R-2330	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NTN4 antibody, catalog no. 70R-7141

Human Netrin 1 ELISA kit
E01N0102-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Netrin 1 ELISA kit
E01N0102-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Netrin 1 ELISA kit
E01N0102-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Netrin G1 ELISA KIT|Human
EF001182	Lifescience Market	96 Tests	EUR 689

NTN4 ELISA Kit (Mouse) (OKCA02417)
OKCA02417	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: May play an important role in neural, kidney and vascular development. Promotes neurite elongation from olfactory bulb explants.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 7.81 pg/mL

NTN4 siRNA
20-abx926510	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NTN4 siRNA
20-abx926511	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human Netrin-1 (NTN1) ELISA Kit
abx575464-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Netrin-1
EK3998	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Netrin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human NTN1/ Netrin-1 ELISA Kit
E1804Hu	Sunlong	1 Kit	EUR 571

Human NTN1(Netrin-1) ELISA Kit
EH1951	FN Test	96T	EUR 524.1
Detection range: 31.25-2000 pg/ml Uniprot ID: O95631 Alias: Ntn1(Netrin 1)/netrin-1/Lnetrin 1, mouse, homolog of
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Netrin- 5, NTN5 ELISA KIT
ELI-22175h	Lifescience Market	96 Tests	EUR 824

Human Netrin- G1, NTNG1 ELISA KIT
ELI-23804h	Lifescience Market	96 Tests	EUR 824

Human Netrin- 1, NTN1 ELISA KIT
ELI-05889h	Lifescience Market	96 Tests	EUR 824

Human Netrin-1(Ntn1)ELISA Kit
GA-E1294HM-48T	GenAsia Biotech	48T	EUR 289

Human Netrin-1(Ntn1)ELISA Kit
GA-E1294HM-96T	GenAsia Biotech	96T	EUR 466

Human Netrin- G2, NTNG2 ELISA KIT
ELI-44497h	Lifescience Market	96 Tests	EUR 824

Human Netrin- 3, NTN3 ELISA KIT
ELI-46178h	Lifescience Market	96 Tests	EUR 824

Human Netrin-1 (NTN1) ELISA Kit
20-abx152483	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Netrin-1 (NTN1) ELISA Kit
abx251273-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Netrin-1,Ntn1 ELISA Kit
201-12-1278	SunredBio	96 tests	EUR 440
This Netrin-1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Netrin 1 (Ntn1) ELISA Kit
DLR-Ntn1-Hu-48T	DL Develop	48T	EUR 498
Should the Human Netrin 1 (Ntn1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Netrin 1 (Ntn1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Netrin 1 (Ntn1) ELISA Kit
DLR-Ntn1-Hu-96T	DL Develop	96T	EUR 647
Should the Human Netrin 1 (Ntn1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Netrin 1 (Ntn1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Netrin-1, Ntn1 ELISA Kit
CSB-E11899h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Netrin-1, Ntn1 in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Netrin-1, Ntn1 ELISA Kit
1-CSB-E11899h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Netrin-1, Ntn1 in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Netrin 1 (Ntn1) ELISA Kit
SEB827Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 1 (Ntn1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 1 (Ntn1) in serum, plasma, tissue homogenates and other biological fluids.

Human Netrin 1 (Ntn1) ELISA Kit
SEB827Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 1 (Ntn1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 1 (Ntn1) in serum, plasma, tissue homogenates and other biological fluids.

Human Netrin 1 (Ntn1) ELISA Kit
SEB827Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 1 (Ntn1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 1 (Ntn1) in serum, plasma, tissue homogenates and other biological fluids.

Human Netrin 1 (Ntn1) ELISA Kit
SEB827Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 1 (Ntn1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 1 (Ntn1) in serum, plasma, tissue homogenates and other biological fluids.

Human Netrin 1 (Ntn1) ELISA Kit
4-SEB827Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Netrin 1 elisa. Alternative names of the recognized antigen: NTN1L Epididymis tissue protein Li 131P
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Netrin 1 (Ntn1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Netrin 1 ELISA Kit (Ntn1)
RK01971	Abclonal	96 Tests	EUR 521

Human Netrin 1 (Ntn1) ELISA Kit
RD-Ntn1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Netrin 1 (Ntn1) ELISA Kit
RD-Ntn1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Netrin 1 (Ntn1) ELISA Kit
RDR-Ntn1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Netrin 1 (Ntn1) ELISA Kit
RDR-Ntn1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Netrin G2(NtnG2)ELISA Kit
QY-E00139	Qayee Biotechnology	96T	EUR 361

Human Netrin G1(NtnG1)ELISA Kit
QY-E00140	Qayee Biotechnology	96T	EUR 361

Human Netrin 5(Ntn5)ELISA Kit
QY-E00141	Qayee Biotechnology	96T	EUR 361

Human Netrin-3(Ntn3)ELISA Kit
QY-E00143	Qayee Biotechnology	96T	EUR 361

Human Netrin-1(Ntn1)ELISA Kit
QY-E00144	Qayee Biotechnology	96T	EUR 361

IL-4 Interleukin 4 Human Recombinant Protein, Yeast
PROTP05112-4	BosterBio	Regular: 10ug	EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human NTN4 shRNA Plasmid
20-abx961762	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NTN4 Recombinant Protein (Human)
RP021772	ABM	100 ug	Ask for price

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-48T	DL Develop	48T	EUR 479
Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-96T	DL Develop	96T	EUR 621
Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Rat Netrin 1 ELISA kit
E02N0102-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Netrin 1 ELISA kit
E02N0102-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Netrin 1 ELISA kit
E02N0102-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Netrin 1 ELISA kit
E03N0102-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Netrin 1 ELISA kit
E03N0102-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Netrin 1 ELISA kit
E03N0102-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Netrin 1 ELISA kit
E04N0102-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Netrin 1 ELISA kit
E04N0102-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Netrin 1 ELISA kit
E04N0102-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Netrin 1 ELISA kit
E08N0102-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Netrin 1 ELISA kit
E08N0102-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Netrin 1 ELISA kit
E08N0102-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Netrin 1 ELISA kit
E09N0102-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Netrin 1 ELISA kit
E09N0102-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Netrin 1 ELISA kit
E09N0102-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Netrin 1 ELISA kit
E07N0102-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Netrin 1 ELISA kit
E07N0102-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Netrin 1 ELISA kit
E07N0102-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Netrin 1 ELISA kit
E06N0102-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Netrin 1 ELISA kit
E06N0102-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Netrin 1 ELISA kit
E06N0102-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Ntn1 (Netrin 1)
E-EL-H2328	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's Ntn1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human Ntn1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human Ntn1 (Netrin 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Netrin receptor UNC5C
EK4779	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Netrin receptor UNC5C in samples from serum, plasma, tissue homogenates and other biological fluids.

Human UNC5B(Netrin Receptor UNC5B) ELISA Kit
EH4330	FN Test	96T	EUR 567.6
Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human UNC5C/ Netrin receptor UNC5C ELISA Kit
E2644Hu	Sunlong	1 Kit	EUR 605

Human UNC5C(Netrin receptor UNC5C) ELISA Kit
EH2373	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: O95185 Alias: UNC5C/UNC5H3/netrin receptor UNC5C/Protein unc-5 homolog 3/Protein unc-5 homolog C/unc-5 homolog 3/unc-5 homolog C(C. elegans)/UNC5H3unc5(C.elegans homolog) c
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Netrin receptor UNC5C, UNC5C ELISA KIT
ELI-16914h	Lifescience Market	96 Tests	EUR 824

Human Netrin receptor UNC5A, UNC5A ELISA KIT
ELI-17718h	Lifescience Market	96 Tests	EUR 824

Human Netrin receptor DCC, DCC ELISA KIT
ELI-28147h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human Ntn1 (Netrin 1)
ELK2210	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Netrin 1 (Ntn1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Netrin 1 (Ntn1). N Show more
Description: A sandwich ELISA kit for detection of Netrin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Netrin receptor UNC5D, UNC5D ELISA KIT
ELI-39862h	Lifescience Market	96 Tests	EUR 824

Human Netrin receptor UNC5B, UNC5B ELISA KIT
ELI-51730h	Lifescience Market	96 Tests	EUR 824

Human Netrin receptor UNC5B (UNC5B) ELISA Kit
abx259097-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human Netrin receptor UNC5A (UNC5A) ELISA Kit
abx384131-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Netrin receptor UNC5D (UNC5D) ELISA Kit
abx384133-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Netrin Receptor DCC (DCC) ELISA Kit
abx386806-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Netrin receptor UNC5C (UNC5C) ELISA Kit
abx251732-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Netrin receptor DCC(DCC) ELISA kit
CSB-EL006536HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Netrin receptor DCC (DCC) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Netrin receptor DCC(DCC) ELISA kit
1-CSB-EL006536HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Netrin receptor DCC(DCC) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human Netrin-1 (NTN1)
KTE62214-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Netrin-1 (NTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Netrin-1 (NTN1)
KTE62214-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Netrin-1 (NTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Netrin-1 (NTN1)
KTE62214-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Netrin-1 (NTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Netrin G1 (Netrin G1) Antibody
20-abx116878	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Netrin G1 (Netrin G1) Antibody
abx433020-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Netrin G1 (Netrin G1) Antibody
abx235667-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

NTN4 Rabbit pAb
A13775-100ul	Abclonal	100 ul	EUR 308

NTN4 Rabbit pAb
A13775-200ul	Abclonal	200 ul	EUR 459

NTN4 Rabbit pAb
A13775-20ul	Abclonal	20 ul	EUR 183

NTN4 Rabbit pAb
A13775-50ul	Abclonal	50 ul	EUR 223

NTN4 Polyclonal Antibody
28347-100ul	SAB	100ul	EUR 252

NTN4 Polyclonal Antibody
28347-50ul	SAB	50ul	EUR 187

NTN4 cloning plasmid
CSB-CL881014HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1026 Sequence: atggtccatgggaagtgtatgtgtaagcacaacacagcaggcagccactgccagcactgtgccccgttatacaatgaccggccatgggaggcagctgatggcaaaacgggggctcccaacgagtgcagaacctgcaagtgtaatgggcatgctgatacctgtcacttcgacgtta Show more
Description: A cloning plasmid for the NTN4 gene.

Anti-NTN4 antibody
STJ115720	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants.

Human FibrOut 4, for brain, neural
4-21552	CHI Scientific	1 ml	Ask for price

Human FibrOut 4, for brain, neural
4-21553	CHI Scientific	5 x 1 ml	Ask for price

Recombinant Human PF-4 (CXCL4) Protein
PROTP02776-4	BosterBio	20ug	EUR 317
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.

Recombinant Human 4-1BB Receptor Protein
PROTQ07011-4	BosterBio	20ug	EUR 317
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.

Monkey Netrin-1 (NTN1) ELISA Kit
abx360025-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Netrin-1 (NTN1) ELISA Kit
abx362619-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Netrin 2 (NTN2) ELISA Kit
20-abx585321	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Rat Netrin-1 (NTN1) ELISA Kit
abx574528-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Netrin-1 (NTN1) ELISA Kit
abx574721-96tests	Abbexa	96 tests	EUR 715
Shipped within 5-12 working days.

Chicken Netrin-1 (NTN1) ELISA Kit
abx574999-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Guinea pig Netrin 1 ELISA kit
E05N0102-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Netrin 1 ELISA kit
E05N0102-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Netrin 1 ELISA kit
E05N0102-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Netrin-1
EK3999	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Netrin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Netrin- 1,Ntn1 ELISA Kit
ELA-E1827m	Lifescience Market	96 Tests	EUR 865

Mouse Ntn1/ Netrin-1 ELISA Kit
E1064Mo	Sunlong	1 Kit	EUR 571

Mouse Netrin- 5, Ntn5 ELISA KIT
ELI-13818m	Lifescience Market	96 Tests	EUR 865

Mouse Netrin- G1, Ntng1 ELISA KIT
ELI-21352m	Lifescience Market	96 Tests	EUR 865

Chicken Netrin- 3, NTN3 ELISA KIT
ELI-23610c	Lifescience Market	96 Tests	EUR 928

Mouse Netrin- 1, Ntn1 ELISA KIT
ELI-05887m	Lifescience Market	96 Tests	EUR 865

Chicken Netrin- 1, NTN1 ELISA KIT
ELI-05888c	Lifescience Market	96 Tests	EUR 928

Porcine Netrin- 1, NTN1 ELISA KIT
ELI-05891p	Lifescience Market	96 Tests	EUR 928

Rat Netrin-1(Ntn1)ELISA Kit
GA-E0780RT-48T	GenAsia Biotech	48T	EUR 317

Rat Netrin-1(Ntn1)ELISA Kit
GA-E0780RT-96T	GenAsia Biotech	96T	EUR 496

Mouse Netrin- 3, Ntn3 ELISA KIT
ELI-44721m	Lifescience Market	96 Tests	EUR 865

Mouse Netrin- G2, Ntng2 ELISA KIT
ELI-46084m	Lifescience Market	96 Tests	EUR 865

Porcine Ntn1(Netrin 1) ELISA Kit
EP0126	FN Test	96T	EUR 567.6
Detection range: 62.5-4000 pg/ml Alias: Ntn1(Netrin 1)/netrin-1/Lnetrin 1, mouse, homolog of
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Pig;Sensitivity: 37.5pg/ml

Mouse Ntn1( Netrin-1) ELISA Kit
EM0685	FN Test	96T	EUR 567.6
Detection range: 31.2-2000 pg/ml Uniprot ID: O09118 Alias: Ntn1/Netrin 1/Lnetrin 1, mouse, homolog of
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml

Rat Netrin-1 (NTN1) ELISA Kit
20-abx155873	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Netrin-1 (NTN1) ELISA Kit
20-abx154447	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Chicken Netrin-1 (NTN1) ELISA Kit
20-abx150048	Abbexa	EUR 5374.00 EUR 2868.00 EUR 676.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Pig Netrin-1 (NTN1) ELISA Kit
abx255540-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Chicken Netrin 1 (Ntn1) ELISA Kit
DLR-Ntn1-Ch-48T	DL Develop	48T	EUR 398
Should the Chicken Netrin 1 (Ntn1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Netrin 1 (Ntn1) in samples from serum, plasma or other biological fluids.

Human Ntn4(Netrin 4) ELISA Kit