Human Ntn4(Netrin 4) ELISA Kit

Human Ntn4(Netrin 4) ELISA Kit

Human Netrin 4 (Ntn4) ELISA Kit

RD-Ntn4-Hu-48Tests 48 Tests
EUR 500

Human Netrin 4 (Ntn4) ELISA Kit

RD-Ntn4-Hu-96Tests 96 Tests
EUR 692

Human Netrin 4 (Ntn4) ELISA Kit

RDR-Ntn4-Hu-48Tests 48 Tests
EUR 522

Human Netrin 4 (Ntn4) ELISA Kit

RDR-Ntn4-Hu-96Tests 96 Tests
EUR 724

Netrin-4 (NTN4)

RA21023 50 ug
EUR 435

Human Netrin-4 (NTN4) ELISA Kit

abx576155-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human NTN4/ Netrin-4 ELISA Kit

E1805Hu 1 Kit
EUR 571

Human NTN4(Netrin-4) ELISA Kit

EH1954 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: Q9HB63
  • Alias: NTN4(Netrin 4)/beta-Netrin/Netrin-4/CDY/CDY1A/chromodomain protein, Y chromosome, 1/chromodomain protein, Y-linked, 1/testis-specific chromodomain protein on Y/testis-specific chromodomain
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Netrin- 4, NTN4 ELISA KIT

ELI-05910h 96 Tests
EUR 824

Human Netrin-4(Ntn4)ELISA Kit

GA-E1314HM-48T 48T
EUR 289

Human Netrin-4(Ntn4)ELISA Kit

GA-E1314HM-96T 96T
EUR 466

Human Netrin-4 (NTN4) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Netrin-4 (NTN4) ELISA Kit

abx251276-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Netrin-4,Ntn4 ELISA Kit

201-12-1298 96 tests
EUR 440
  • This Netrin-4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Netrin-4, Ntn4 ELISA Kit

CSB-E11900h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Netrin-4, Ntn4 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Netrin-4, Ntn4 ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Netrin-4, Ntn4 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Netrin 4 (Ntn4) ELISA Kit

SEB835Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 4 (Ntn4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 4 (Ntn4) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Netrin 4 (Ntn4) ELISA Kit

SEB835Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 4 (Ntn4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 4 (Ntn4) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Netrin 4 (Ntn4) ELISA Kit

SEB835Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 4 (Ntn4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 4 (Ntn4) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Netrin 4 (Ntn4) ELISA Kit

SEB835Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 4 (Ntn4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 4 (Ntn4) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Netrin 4 (Ntn4) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Netrin 4 elisa. Alternative names of the recognized antigen: Beta-Netrin
  • Hepar-derived netrin-like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Netrin 4 (Ntn4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Netrin 4 ELISA Kit (Ntn4)

RK01972 96 Tests
EUR 521

Human Netrin-4(Ntn4)ELISA Kit

QY-E00142 96T
EUR 361

Netrin 4 (Ntn4) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Netrin 4 (Ntn4) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Netrin-4 (NTN4) Antibody

abx432030-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Recombinant Netrin 4 (Ntn4)

  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9HB63
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 59.3kDa
  • Isoelectric Point: 7
Description: Recombinant Human Netrin 4 expressed in: E.coli

Mouse Netrin-4 (NTN4) ELISA Kit

abx518574-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Monkey Netrin-4 (NTN4) ELISA Kit

abx360314-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Netrin-4 (NTN4) ELISA Kit

abx362075-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Netrin-4 (NTN4) ELISA Kit

abx363302-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Netrin- 4, Ntn4 ELISA KIT

ELI-05909m 96 Tests
EUR 865

Sheep Netrin-4 (NTN4) ELISA Kit

abx364688-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Chicken Netrin-4 (NTN4) ELISA Kit

abx356839-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Netrin-4(NTN4) ELISA kit

CSB-EL016129MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Netrin-4 (NTN4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Netrin-4(NTN4) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Netrin-4(NTN4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Netrin 4 (Ntn4) Protein

  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Netrin-4 (NTN4) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Netrin 4 (Ntn4) CLIA Kit

abx197331-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Human Ntn4 (Netrin 4)

E-EL-H2329 1 plate of 96 wells
EUR 534
  • Gentaur's Ntn4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human Ntn4. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human Ntn4 (Netrin 4) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Ntn4 (Netrin 4)

ELK2211 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Netrin 4 (Ntn4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Netrin 4 (Ntn4). N
  • Show more
Description: A sandwich ELISA kit for detection of Netrin 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

CLIA kit for Human Ntn4 (Netrin 4)

E-CL-H1361 1 plate of 96 wells
EUR 584
  • Gentaur's Ntn4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human Ntn4 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human Ntn4 (Netrin 4) in samples from Serum, Plasma, Cell supernatant

Netrin 4 (Ntn4) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ntn4 (Glu349~His592)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4)

Netrin 4 (Ntn4) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ntn4 (Glu349~His592)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with APC.

Netrin 4 (Ntn4) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ntn4 (Glu349~His592)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with Biotin.

Netrin 4 (Ntn4) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ntn4 (Glu349~His592)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with Cy3.

Netrin 4 (Ntn4) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ntn4 (Glu349~His592)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with FITC.

Netrin 4 (Ntn4) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ntn4 (Glu349~His592)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with HRP.

Netrin 4 (Ntn4) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ntn4 (Glu349~His592)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with PE.

Netrin 4 (Ntn4) Polyclonal Antibody (Human), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ntn4 (Glu349~His592)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with APC-Cy7.


GT15164 100 ug
EUR 526

Human NTN4 ELISA Kit

ELA-E1835h 96 Tests
EUR 824


EF006061 96 Tests
EUR 689

Netrin 4 antibody

70R-7141 50 ug
EUR 467
Description: Rabbit polyclonal Netrin 4 antibody raised against the N terminal of NTN4

NTN4 ELISA Kit (Human) (OKAN05746)

OKAN05746 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.5 pg/mL

NTN4 ELISA Kit (Human) (OKCD07716)

OKCD07716 96 Wells
EUR 936
Description: Description of target: NTN4 contains 3 laminin EGF-like domains, 1 laminin N-terminal domain and 1 NTR domain. NTN4 may play an important role in neural, kidney and vascular development. It promotes neurite elongation from olfactory bulb explants. NTN4 belongs to a family of proteins related to laminins (see LAMA1, MIM 150320) Koch et al. (2000)....;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 3.1pg/mL

NTN4 ELISA Kit (Human) (OKEH04720)

OKEH04720 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL

Netrin 4 Blocking Peptide

33R-2330 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NTN4 antibody, catalog no. 70R-7141

Human Netrin 1 ELISA kit

E01N0102-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Netrin 1 ELISA kit

E01N0102-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Netrin 1 ELISA kit

E01N0102-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Netrin G1 ELISA KIT|Human

EF001182 96 Tests
EUR 689

NTN4 ELISA Kit (Mouse) (OKCA02417)

OKCA02417 96 Wells
EUR 846
Description: Description of target: May play an important role in neural, kidney and vascular development. Promotes neurite elongation from olfactory bulb explants.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 7.81 pg/mL


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human Netrin-1 (NTN1) ELISA Kit

abx575464-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Netrin-1

EK3998 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Netrin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human NTN1/ Netrin-1 ELISA Kit

E1804Hu 1 Kit
EUR 571

Human NTN1(Netrin-1) ELISA Kit

EH1951 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: O95631
  • Alias: Ntn1(Netrin 1)/netrin-1/Lnetrin 1, mouse, homolog of
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Netrin- 5, NTN5 ELISA KIT

ELI-22175h 96 Tests
EUR 824

Human Netrin- G1, NTNG1 ELISA KIT

ELI-23804h 96 Tests
EUR 824

Human Netrin- 1, NTN1 ELISA KIT

ELI-05889h 96 Tests
EUR 824

Human Netrin-1(Ntn1)ELISA Kit

GA-E1294HM-48T 48T
EUR 289

Human Netrin-1(Ntn1)ELISA Kit

GA-E1294HM-96T 96T
EUR 466

Human Netrin- G2, NTNG2 ELISA KIT

ELI-44497h 96 Tests
EUR 824

Human Netrin- 3, NTN3 ELISA KIT

ELI-46178h 96 Tests
EUR 824

Human Netrin-1 (NTN1) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Netrin-1 (NTN1) ELISA Kit

abx251273-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Netrin-1,Ntn1 ELISA Kit

201-12-1278 96 tests
EUR 440
  • This Netrin-1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Netrin 1 (Ntn1) ELISA Kit

DLR-Ntn1-Hu-48T 48T
EUR 498
  • Should the Human Netrin 1 (Ntn1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Netrin 1 (Ntn1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Netrin 1 (Ntn1) ELISA Kit

DLR-Ntn1-Hu-96T 96T
EUR 647
  • Should the Human Netrin 1 (Ntn1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Netrin 1 (Ntn1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Netrin-1, Ntn1 ELISA Kit

CSB-E11899h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Netrin-1, Ntn1 in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Netrin-1, Ntn1 ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Netrin-1, Ntn1 in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Netrin 1 (Ntn1) ELISA Kit

SEB827Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 1 (Ntn1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 1 (Ntn1) in serum, plasma, tissue homogenates and other biological fluids.

Human Netrin 1 (Ntn1) ELISA Kit

SEB827Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 1 (Ntn1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 1 (Ntn1) in serum, plasma, tissue homogenates and other biological fluids.

Human Netrin 1 (Ntn1) ELISA Kit

SEB827Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 1 (Ntn1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 1 (Ntn1) in serum, plasma, tissue homogenates and other biological fluids.

Human Netrin 1 (Ntn1) ELISA Kit

SEB827Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 1 (Ntn1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 1 (Ntn1) in serum, plasma, tissue homogenates and other biological fluids.

Human Netrin 1 (Ntn1) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Netrin 1 elisa. Alternative names of the recognized antigen: NTN1L
  • Epididymis tissue protein Li 131P
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Netrin 1 (Ntn1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Netrin 1 ELISA Kit (Ntn1)

RK01971 96 Tests
EUR 521

Human Netrin 1 (Ntn1) ELISA Kit

RD-Ntn1-Hu-48Tests 48 Tests
EUR 500

Human Netrin 1 (Ntn1) ELISA Kit

RD-Ntn1-Hu-96Tests 96 Tests
EUR 692

Human Netrin 1 (Ntn1) ELISA Kit

RDR-Ntn1-Hu-48Tests 48 Tests
EUR 522

Human Netrin 1 (Ntn1) ELISA Kit

RDR-Ntn1-Hu-96Tests 96 Tests
EUR 724

Human Netrin G2(NtnG2)ELISA Kit

QY-E00139 96T
EUR 361

Human Netrin G1(NtnG1)ELISA Kit

QY-E00140 96T
EUR 361

Human Netrin 5(Ntn5)ELISA Kit

QY-E00141 96T
EUR 361

Human Netrin-3(Ntn3)ELISA Kit

QY-E00143 96T
EUR 361

Human Netrin-1(Ntn1)ELISA Kit

QY-E00144 96T
EUR 361

IL-4 Interleukin 4 Human Recombinant Protein, Yeast

PROTP05112-4 Regular: 10ug
EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human NTN4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NTN4 Recombinant Protein (Human)

RP021772 100 ug Ask for price

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

DLR-CA72-4-Hu-48T 48T
EUR 479
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

DLR-CA72-4-Hu-96T 96T
EUR 621
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RD-CA72-4-Hu-48Tests 48 Tests
EUR 478

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RD-CA72-4-Hu-96Tests 96 Tests
EUR 662

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RDR-CA72-4-Hu-48Tests 48 Tests
EUR 500

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RDR-CA72-4-Hu-96Tests 96 Tests
EUR 692

Rat Netrin 1 ELISA kit

E02N0102-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Netrin 1 ELISA kit

E02N0102-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Netrin 1 ELISA kit

E02N0102-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Netrin 1 ELISA kit

E03N0102-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Netrin 1 ELISA kit

E03N0102-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Netrin 1 ELISA kit

E03N0102-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Netrin 1 ELISA kit

E04N0102-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Netrin 1 ELISA kit

E04N0102-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Netrin 1 ELISA kit

E04N0102-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Netrin 1 ELISA kit

E08N0102-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Netrin 1 ELISA kit

E08N0102-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Netrin 1 ELISA kit

E08N0102-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Netrin 1 ELISA kit

E09N0102-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Netrin 1 ELISA kit

E09N0102-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Netrin 1 ELISA kit

E09N0102-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Netrin 1 ELISA kit

E07N0102-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Netrin 1 ELISA kit

E07N0102-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Netrin 1 ELISA kit

E07N0102-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Netrin 1 ELISA kit

E06N0102-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Netrin 1 ELISA kit

E06N0102-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Netrin 1 ELISA kit

E06N0102-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Ntn1 (Netrin 1)

E-EL-H2328 1 plate of 96 wells
EUR 534
  • Gentaur's Ntn1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human Ntn1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human Ntn1 (Netrin 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Netrin receptor UNC5C

EK4779 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Netrin receptor UNC5C in samples from serum, plasma, tissue homogenates and other biological fluids.

Human UNC5B(Netrin Receptor UNC5B) ELISA Kit

EH4330 96T
EUR 567.6
  • Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human UNC5C/ Netrin receptor UNC5C ELISA Kit

E2644Hu 1 Kit
EUR 605

Human UNC5C(Netrin receptor UNC5C) ELISA Kit

EH2373 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O95185
  • Alias: UNC5C/UNC5H3/netrin receptor UNC5C/Protein unc-5 homolog 3/Protein unc-5 homolog C/unc-5 homolog 3/unc-5 homolog C(C. elegans)/UNC5H3unc5(C.elegans homolog) c
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Netrin receptor UNC5C, UNC5C ELISA KIT

ELI-16914h 96 Tests
EUR 824

Human Netrin receptor UNC5A, UNC5A ELISA KIT

ELI-17718h 96 Tests
EUR 824

Human Netrin receptor DCC, DCC ELISA KIT

ELI-28147h 96 Tests
EUR 824

ELISA kit for Human Ntn1 (Netrin 1)

ELK2210 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Netrin 1 (Ntn1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Netrin 1 (Ntn1). N
  • Show more
Description: A sandwich ELISA kit for detection of Netrin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Netrin receptor UNC5D, UNC5D ELISA KIT

ELI-39862h 96 Tests
EUR 824

Human Netrin receptor UNC5B, UNC5B ELISA KIT

ELI-51730h 96 Tests
EUR 824

Human Netrin receptor UNC5B (UNC5B) ELISA Kit

abx259097-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Netrin receptor UNC5A (UNC5A) ELISA Kit

abx384131-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Netrin receptor UNC5D (UNC5D) ELISA Kit

abx384133-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Netrin Receptor DCC (DCC) ELISA Kit

abx386806-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Netrin receptor UNC5C (UNC5C) ELISA Kit

abx251732-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Netrin receptor DCC(DCC) ELISA kit

CSB-EL006536HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Netrin receptor DCC (DCC) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Netrin receptor DCC(DCC) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Netrin receptor DCC(DCC) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human Netrin-1 (NTN1)

KTE62214-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Netrin-1 (NTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Netrin-1 (NTN1)

KTE62214-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Netrin-1 (NTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Netrin-1 (NTN1)

KTE62214-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Netrin-1 (NTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Netrin G1 (Netrin G1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Netrin G1 (Netrin G1) Antibody

abx433020-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Netrin G1 (Netrin G1) Antibody

abx235667-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

NTN4 Rabbit pAb

A13775-100ul 100 ul
EUR 308

NTN4 Rabbit pAb

A13775-200ul 200 ul
EUR 459

NTN4 Rabbit pAb

A13775-20ul 20 ul
EUR 183

NTN4 Rabbit pAb

A13775-50ul 50 ul
EUR 223

NTN4 Polyclonal Antibody

28347-100ul 100ul
EUR 252

NTN4 Polyclonal Antibody

28347-50ul 50ul
EUR 187

NTN4 cloning plasmid

CSB-CL881014HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1026
  • Sequence: atggtccatgggaagtgtatgtgtaagcacaacacagcaggcagccactgccagcactgtgccccgttatacaatgaccggccatgggaggcagctgatggcaaaacgggggctcccaacgagtgcagaacctgcaagtgtaatgggcatgctgatacctgtcacttcgacgtta
  • Show more
Description: A cloning plasmid for the NTN4 gene.

Anti-NTN4 antibody

STJ115720 100 µl
EUR 277
Description: This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants.

Human FibrOut 4, for brain, neural

4-21552 1 ml Ask for price

Human FibrOut 4, for brain, neural

4-21553 5 x 1 ml Ask for price

Recombinant Human PF-4 (CXCL4) Protein

PROTP02776-4 20ug
EUR 317
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.

Recombinant Human 4-1BB Receptor Protein

PROTQ07011-4 20ug
EUR 317
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.

Monkey Netrin-1 (NTN1) ELISA Kit

abx360025-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Netrin-1 (NTN1) ELISA Kit

abx362619-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Netrin 2 (NTN2) ELISA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Rat Netrin-1 (NTN1) ELISA Kit

abx574528-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Netrin-1 (NTN1) ELISA Kit

abx574721-96tests 96 tests
EUR 715
  • Shipped within 5-12 working days.

Chicken Netrin-1 (NTN1) ELISA Kit

abx574999-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Guinea pig Netrin 1 ELISA kit

E05N0102-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Netrin 1 ELISA kit

E05N0102-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Netrin 1 ELISA kit

E05N0102-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Netrin-1

EK3999 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Netrin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Netrin- 1,Ntn1 ELISA Kit

ELA-E1827m 96 Tests
EUR 865

Mouse Ntn1/ Netrin-1 ELISA Kit

E1064Mo 1 Kit
EUR 571

Mouse Netrin- 5, Ntn5 ELISA KIT

ELI-13818m 96 Tests
EUR 865

Mouse Netrin- G1, Ntng1 ELISA KIT

ELI-21352m 96 Tests
EUR 865

Chicken Netrin- 3, NTN3 ELISA KIT

ELI-23610c 96 Tests
EUR 928

Mouse Netrin- 1, Ntn1 ELISA KIT

ELI-05887m 96 Tests
EUR 865

Chicken Netrin- 1, NTN1 ELISA KIT

ELI-05888c 96 Tests
EUR 928

Porcine Netrin- 1, NTN1 ELISA KIT

ELI-05891p 96 Tests
EUR 928

Rat Netrin-1(Ntn1)ELISA Kit

GA-E0780RT-48T 48T
EUR 317

Rat Netrin-1(Ntn1)ELISA Kit

GA-E0780RT-96T 96T
EUR 496

Mouse Netrin- 3, Ntn3 ELISA KIT

ELI-44721m 96 Tests
EUR 865

Mouse Netrin- G2, Ntng2 ELISA KIT

ELI-46084m 96 Tests
EUR 865

Porcine Ntn1(Netrin 1) ELISA Kit

EP0126 96T
EUR 567.6
  • Detection range: 62.5-4000 pg/ml
  • Alias: Ntn1(Netrin 1)/netrin-1/Lnetrin 1, mouse, homolog of
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Pig;Sensitivity: 37.5pg/ml

Mouse Ntn1( Netrin-1) ELISA Kit

EM0685 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: O09118
  • Alias: Ntn1/Netrin 1/Lnetrin 1, mouse, homolog of
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml

Rat Netrin-1 (NTN1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Netrin-1 (NTN1) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Chicken Netrin-1 (NTN1) ELISA Kit

  • EUR 5374.00
  • EUR 2868.00
  • EUR 676.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Pig Netrin-1 (NTN1) ELISA Kit

abx255540-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Chicken Netrin 1 (Ntn1) ELISA Kit

DLR-Ntn1-Ch-48T 48T
EUR 398
  • Should the Chicken Netrin 1 (Ntn1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Netrin 1 (Ntn1) in samples from serum, plasma or other biological fluids.

Human Ntn4(Netrin 4) ELISA Kit